설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTGTCCTTCACCACGAGATCATCTGGCCATCTGGGTTTGTCTGTGATGGCTGTTTAAAGAAAACTGCACGAACTAGGAAAGAAAATAAGCTTTCTGCTAAAAGATTGCCATCTACCAGACTTGGGACCTTTCTGGAGAATCGAGTGAATGACTTTCTGAGGCGACAAAATCACCCTGAATCAGGAGAGGTCACTGTTCGGGTTGTTCATGCTTCTGACAAAACTGTGGAAGTGAAACCAGGCATGAAAGCAAGGTTTGTAGATAGTGGAGAGATGGCAGAATCTTTTCCATACCGAACAAAGGCCCTGTTTGCCTTTGAAGAAATTGATGGTGTTGACTTGTGTTTCTTCGGCATGCATGTTCAAGAATATGGCTCTGACTGCCCCCCTCCCAACCAGAGGAGGGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse  ...  EP300(328572),   Ep300(328572)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Erli Zhang et al.
PloS one, 10(12), e0143814-e0143814 (2015-12-03)
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and
Jihong Chen et al.
Scientific reports, 5, 13727-13727 (2015-09-12)
Skeletal myogenesis is a highly ordered process which specifically depends on the function of transcriptional coactivator p300. Previous studies have established that Akt/protein kinase B (PKB), a positive regulator of p300 in proliferating cells, is also important for proper skeletal
Smita S Ghare et al.
Journal of immunology (Baltimore, Md. : 1950), 193(1), 412-421 (2014-06-06)
Activation-induced Fas ligand (FasL) mRNA expression in CD4+ T cells is mainly controlled at transcriptional initiation. To elucidate the epigenetic mechanisms regulating physiologic and pathologic FasL transcription, TCR stimulation-responsive promoter histone modifications in normal and alcohol-exposed primary human CD4+ T
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.