설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCGGAGACGAGTTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGGTTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGACAGGATCTACATGCAGCCAGGATACGTGGCGGACATGGCTCTTGTTCAGACTGGGAGAACCCCCACGCGTCATGTCCCTCTCTTGGTGCTGCGACAGTGTGTCCAGTGGTTCTATCCCAGAGAGATGTGCTGAGCATGGACAGCGCTCTGCACTGTGTCGATGTGAACGGAACCTCTGTTCATCACCACATGGCCGAGTTTTCAGTAAATATTTGTTGTGAATGTAAACAAGGGAGGGCTTTTCTCTTTTTAATGTACAGATCCTAGGAACAGAGAAATATGCAAGAGAGGTGTTTACATGTGGCGTG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... BCL2L11(12125), Bcl2l11(12125)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Oluwafunmilayo F Lamidi et al.
Journal of cancer research and clinical oncology, 141(9), 1575-1583 (2015-01-31)
Tubulysins are natural tetrapeptides that inhibit tubulin polymerisation. Tubulysins are very potent inhibitors of mammalian cancer cell growth, but restricted availability has limited their characterisation and development as anti-cancer compounds. KEMTUB10 was recently developed as a synthetic analogue of natural
Gong-Quan Li et al.
Oncotarget, 7(3), 2462-2474 (2015-11-18)
Bromodomain 4 (BRD4) is an epigenetic regulator that, when inhibited, has anti-cancer effects. In this study, we investigated whether BRD4 could be a target for treatment of human hepatocellular carcinoma (HCC). We show that BRD4 is over-expressed in HCC tissues.
S L Locatelli et al.
Leukemia, 28(9), 1861-1871 (2014-02-25)
Relapsed/refractory Hodgkin's lymphoma (HL) is an unmet medical need requiring new therapeutic options. Interactions between the histone deacetylase inhibitor Givinostat and the RAF/MEK/ERK inhibitor Sorafenib were examined in HDLM-2 and L-540 HL cell lines. Exposure to Givinostat/Sorafenib induced a synergistic
Anja Heinemann et al.
Oncotarget, 6(25), 21507-21521 (2015-06-19)
Histone acetylation marks have an important role in controlling gene expression and are removed by histone deacetylases (HDACs). These marks are read by bromodomain and extra-terminal (BET) proteins and novel inhibitiors of these proteins are currently in clinical development. Inhibitors
Lin Deng et al.
The Journal of general virology, 96(9), 2670-2683 (2015-08-25)
We previously reported that hepatitis C virus (HCV) infection induces Bax-triggered, mitochondrion-mediated apoptosis by using the HCV J6/JFH1 strain and Huh-7.5 cells. However, it was still unclear how HCV-induced Bax activation. In this study, we showed that the HCV-induced activation
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.