설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTCCTCGGCTGCAGATTAACTGCGCCTATTTCACCACCATTGCAAGGCCAACTATGGACAGCAAGAAGAACCTGGAGATTTGGGGTATCAAGTGCCGACTGACTCTGCAAAAGCCCAGTTGTCTATGAAGTGCTTACCGCAGAGCGGTGTTTCCTCTGGAACGAGGAAAGCAGGCAGCAAGTCCGCATGCTGGAGACCTTGGTTACTCTTCCTATTGGCTTTGCCTTAGCCTTCACTTTATATGTATGTTAGGGAACCATTTGCGAGGGGGACAGCCACGAAGTGTTACTTTTTCAAAACTATAGAGCCGATTCTGTCAGTGCTGTGCCCTAAGGGCCTAAGCGGCAGGTCTTTGGAGATTTTAGGAGAGCCTATGATTTCAGCATGCTTTTTTAAAAGCGACATTTGAGCCAAC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... SKP2(27401), Skp2(27401)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Wenfu Lu et al.
Oncotarget, 6(2), 771-788 (2015-01-19)
Aberrant elevation of JARID1B and histone H3 lysine 4 trimethylation (H3K4me3) is frequently observed in many diseases including prostate cancer (PCa), yet the mechanisms on the regulation of JARID1B and H3K4me3 through epigenetic alterations still remain poorly understood. Here we
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.