콘텐츠로 건너뛰기
Merck

EMU064851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk3

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACACGCAGCTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCAGCTTATGACCACGTGCGCAAGACCAGAGTGGCCATCAAGAAGATCAGCCCCTTTGAGCATCAAACCTACTGTCAGCGCACGCTGAGGGAGATCCAGATCTTGCTGCGATTCCGCCATGAGAATGTTATAGGCATCCGAGACATCCTCAGAGCGCCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTCAGGACCTCATGGAGACAGACCTGTACAAGCTGCTTAAAAGCCAGCAGCTGAGCAATGACCACATCTGCTACTTCCTCTACCAGATCCTCCGGGGCCTCAAGTATATACACTCAGCCAATGTGCTGCACCGGGACCTGAAGCCTTCCAATCTGCTTATCAACACCACCTGCGA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Juan Zhao et al.
PloS one, 9(10), e108005-e108005 (2014-10-11)
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine-induced hepatic cirrhosis and examined the effects of
Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling
Tabish Hasan Khan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3644-3653 (2014-09-05)
CD40 plays dual immunoregulatory roles in Leishmania major infection and tumor regression. The functional duality emerges from CD40-induced reciprocal p38MAPK and ERK-1/2 phosphorylations. Because phosphotyrosine-based signaling in hematopoietic cells is regulated by the phosphotyrosine phosphatase SHP-1, which is not implied
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Ting Li et al.
Acta pharmacologica Sinica, 36(12), 1503-1513 (2015-11-26)
Platycodin D, the main saponin isolated from Chinese herb Platycodonis Radix, exhibits anticancer activities against various cancer cell lines. Here we evaluated its anticancer action against human hepatocellular carcinoma cells in vitro and in vivo, and elucidated the relationship between

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.