설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCAGAAGTTGGCTGAGAACAAGAGTCAGGGCTCCACTGCCTCGCAAGGATCCCAGAACAAGCAGCCTTTCACTATTGACAACTTTGAGATTGGGCGTCCTTTGGGCAAAGGCAAATTTGGAAACGTGTACTTGGCTCGGGAGAAGAAGAGCCGTTTCATCGTGGCACTCAAGATCCTCTTCAAGTCTCAGATTGAGAAGGAGGGGGTAGAGCACCAGCTTCGCCGAGAGATCGAAATCCAGGCGCACCTGAAACATCCCAACATCCTTCAACTCTACAACTACTTCTACGACCAGCAGAGGATCTACTTAATCCTGGAATACGCCCCTCGCGGGGAACTCTACAAGGAACTGCAGAAGAGTCGGACCTTCGATGAGCAGCGGACTGCCACGATCATGGAGGAACTGTCAGATGCCCTGACCTACTGCCACAAGAAGAAGGTAATTCACAGAGACATAAAGCCGGAGAACCTGCTGTTAGGTCTGCAGGGAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... AURKB(20877), Aurkb(20877)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Lijuan Zhu et al.
The Journal of biological chemistry, 290(45), 27053-27066 (2015-09-18)
Mitotic chromosome segregation is orchestrated by the dynamic interaction of spindle microtubules with the kinetochores. During chromosome alignment, kinetochore-bound microtubules undergo dynamic cycles between growth and shrinkage, leading to an oscillatory movement of chromosomes along the spindle axis. Although kinetochore
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.