콘텐츠로 건너뛰기
Merck

EMU041221

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gpr109a

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCTTGCTTCTTGTGGGGTCTCACCATCGGCCTGACTGTCCACCTCCTCTATACAAACATGATGACCAAAAATGGCGAGGCATATCTGTGTAGCAGCTTCAGCATCTGTTACAACTTCAGGTGGCACGATGCTATGTTCCTCTTGGAATTCTTCTTGCCCCTGGCCATCATCTTGTTCTGCTCAGGCAGGATCATCTGGAGCCTGAGGCAGAGACAGATGGACAGACATGCCAAGATCAAGAGGGCCATCAACTTCATCATGGTGGTGGCTATTGTATTCATCATTTGCTTCCTACCCAGTGTGGCTGTGCGCATCCGCATCTTCTGGCTTCTCTACAAATATAACGTACGCAACTGTGACATCTACTCCTCGGTGGACCTGGCTTTCTTTACCACCCTTAGCTTTACCTACATGAACAGCATGCTGGACCCTGTGGTCTACTATTTCTCCAGCCCATCTTTCCCCAACTTCTTCTCCACGTGTATCAACCGCTGCCTTCGAAAGAAAACATTGGGTGAACCCGATA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Genki Hayashi et al.
Human molecular genetics, 26(15), 2864-2873 (2017-05-02)
The induction of mitochondrial biogenesis could potentially alleviate mitochondrial and muscle disease. We show here that dimethyl fumarate (DMF) dose-dependently induces mitochondrial biogenesis and function dosed to cells in vitro, and also dosed in vivo to mice and humans. The
Banabihari Giri et al.
International journal of molecular sciences, 20(18) (2019-09-22)
In this study, we used macrophage RAW264.7 cells to elucidate the molecular mechanism underlying the anti-inflammatory actions of niacin. Anti-inflammatory actions of niacin and a possible role of its receptor GPR109A have been studied previously. However, the precise molecular mechanism
Samar Rezq et al.
The Journal of pharmacology and experimental therapeutics, 356(2), 456-465 (2015-12-02)
G protein-coupled receptor 109A (GPR109A) activation by its ligand nicotinic acid (NA) in immune cells increases Ca(2+) levels, and Ca(2+) induces glutamate release and oxidative stress in central blood pressure (BP)-regulating nuclei, for example, the rostral ventrolateral medulla (RVLM), leading
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.