설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGGCAAGAGGTTGCTATCAAGCAGATTAATTTACAGAAACAACCAAAGAAGGAATTGATCATTAATGAAATTCTGGTGATGAAAGAGTTAAAGAATCCCAACATAGTTAACTTCTTGGACAGTTACCTGGTAGGAGATGAGTTGTTTGTGGTAATGGAGTACCTCGCTGGTGGGTCCCTCACTGATGTTGTAACAGAAACCTGCATGGACGAAGCGCAGATTGCCGCCGTGTGCAGAGAGTGTTTACAGGCGTTGGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATGTGCTTTTGGGAATGGAAGGCTCAGTTAAACTTACTGACTTCGGCTTCTGTGCCCAGATCACTCCTGAACAGAGCAAACGCAGTACTATGGTTGGAACACCGTACTGGATGGCACCAGAGGTGGTGACACGGAAAGCCTATGGTCCCAAAGTTGACATATGGTCTCTGGGCATCATGGCTATCGAGATGGTTGAAGGAGAGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse  ...  PAK2(224105),   Pak2(224105)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.