설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTCACACAGCGAGGACTCAAGACAGTGTTTGACGAAGCTATCCGAGCGGTTCTCTGTCCCCCTCCTGTCAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCGGAGCCCCTCGTTCTCGGTCCTGCCTGGAACCTTTGTACGCTTTGCTCAAAAATCAGCGAGCCTTCGCATTTGATGCCAAGTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTGAACCAATGAACCAGTCAATAATTTTAAGGTTCTGTTTTAAATGTAAGAATTCCAACTTACAGTCTATTAAAATTCAGCCCTAAAATGACAAAGCCTTCTTAAAGCCTTATTTTTAAAATCCCCCATTCTTGCTCAGATTAAAAATTGCCAAAATACCTTCTGAACTAAGTTGCGTTGTGCTGAGAACACCTAAGCACTAAACTCTCTTGAGAGACTTCTGTTGCTAAGAAGACCGCAGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... RAC1(19353), Rac1(19353)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Vianey Gonzalez-Villasana et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(9), 2127-2137 (2015-01-18)
Zoledronic acid is being increasingly recognized for its antitumor properties, but the underlying functions are not well understood. In this study, we hypothesized that zoledronic acid inhibits ovarian cancer angiogenesis preventing Rac1 activation. The biologic effects of zoledronic acid were
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.