콘텐츠로 건너뛰기
Merck

EMU014921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Parp1

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCCATCAAGAATGAAGGAAAGAGAAAAGGTGACGAGGTGGATGGAACAGATGAAGTGGCCAAAAAGAAATCTAAGAAAGGGAAGGACAAGGATAGTAGTAAGCTGGAGAAGGCCCTCAAGGCTCAGAATGAGCTGATCTGGAATATCAAAGACGAGCTGAAGAAAGCGTGTTCCACCAACGACCTGAAGGAGCTGCTCATCTTCAACCAGCAGCAGGTGCCGTCAGGAGAGTCAGCGATCTTGGACAGAGTTGCTGACGGCATGGCGTTTGGGGCCCTTCTGCCCTGCAAGGAGTGTTCAGGCCAGCTGGTCTTTAAGAGCGACGCTTATTACTGTACTGGGGATGTCACTGCCTGGACCAAGTGCATGGTCAAGACACAGAATCCTAGCCGAAAGGAATGGGTAACTCCAAAGGAATTCCGAGAAA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Hui Peng et al.
PloS one, 10(5), e0125318-e0125318 (2015-05-21)
Microsomal epoxide hydrolase (mEH) is a bifunctional protein that plays a central role in the metabolism of numerous xenobiotics as well as mediating the sodium-dependent transport of bile acids into hepatocytes. These compounds are involved in cholesterol homeostasis, lipid digestion
Hyeon-Jun Shin et al.
Scientific reports, 5, 15798-15798 (2015-11-03)
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.