콘텐츠로 건너뛰기
Merck

EHU223451

Sigma-Aldrich

MISSION® esiRNA

targeting human POU5F1 (2)

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shaoheng Zhang et al.
Cell death & disease, 8(1), e2548-e2548 (2017-01-13)
Poor cell survival and limited functional benefits have restricted mesenchymal stem cell (MSC) efficacy for treating myocardial infarction (MI), suggesting that a better understanding of stem cell biology is needed. The transcription factor HIF-2α is an essential regulator of the
Axel R Göhring et al.
PloS one, 12(4), e0174912-e0174912 (2017-04-21)
Oct4 was reported to be one of the most important pluripotency transcription factors in the biology of stem cells including cancer stem cells, and progressed malignant cells. Here we report the investigation of gene expression control of Oct4 by selected
Pengmu Xie et al.
Experimental and molecular pathology, 108, 9-16 (2019-03-12)
Endometrial cancer (EC) is ranked as the most common gynecologic malignancy of the female genital tract and the fourth most common neoplasia in women. Accumulated evidences reveal that TRAF4 plays a critical role in the progress of various cancers, but
Lei Liu et al.
Biochemical and biophysical research communications, 461(3), 525-532 (2015-04-26)
Our previous study showed that Octamer-binding transcription factor 4 (OCT4) expression was upregulated and significantly associated with histological grade through the analysis of OCT4 expression in 159 ovarian cancer tissue samples, and OCT4 mediated follicle-stimulating hormone (FSH)-induced anti-apoptosis in epithelial
Ting Zhao et al.
Cell stem cell, 23(1), 31-45 (2018-06-26)
Chemical reprogramming provides a powerful platform for exploring the molecular dynamics that lead to pluripotency. Although previous studies have uncovered an intermediate extraembryonic endoderm (XEN)-like state during this process, the molecular underpinnings of pluripotency acquisition remain largely undefined. Here, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.