설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Pei-Chi Chan et al.
Clinical science (London, England : 1979), 132(14), 1581-1596 (2018-05-19)
Adipose tissue (AT) inflammation is crucial to the development of obesity-associated insulin resistance. Our aim was to investigate the contribution of cyclooxygenase-2 (COX-2)/macrophage migration inhibitory factor (MIF)-mediated cross-talk between hypertrophic adipocytes and macrophages to the etiology of AT inflammation and
Jun-Wei Gai et al.
Oncology letters, 15(5), 7631-7638 (2018-05-08)
The aim of the present study was to investigate the expression and potential roles of CD74 in human urothelial cell carcinoma of the bladder (UCB) in vitro and in vivo. CD74 and macrophage migration inhibitory factor (MIF) were located and
Jing-Nan Liang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2441-2450 (2019-06-09)
Although macrophage migration inhibitory factor (MIF) is known to have antioxidant property, the role of MIF in cardiac fibrosis has not been well understood. We found that MIF was markedly increased in angiotension II (Ang-II)-infused mouse myocardium. Myocardial function was
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.