설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGATCACCACTAACTCAGAGCCTCCTCCAGGCCAAACAGCCCCAAAGTCAAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ADIPOQ(9370), ADIPOQ(9370)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yuu Okura et al.
International journal of molecular sciences, 20(7) (2019-04-03)
Both adiponectin and secreted protein, acidic and rich in cysteine (SPARC) inhibit platelet-derived growth factor-BB (PDGF-BB)-induced and basic fibroblast growth factor (FGF2)-induced angiogenic activities through direct and indirect interactions. Although SPARC enhances nerve growth factor (NGF)-dependent neurogenesis, the physical interaction
Roberta G Marangoni et al.
Scientific reports, 7(1), 4397-4397 (2017-07-02)
Skin fibrosis in systemic sclerosis (SSc) is accompanied by attrition of dermal white adipose tissue (dWAT) and reduced levels of circulating adiponectin. Since adiponectin has potent regulatory effects on fibroblasts, we sought to assess adiponectin signaling in SSc skin biopsies
Juhyun Song et al.
Cell death & disease, 8(10), e3102-e3102 (2017-10-13)
Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by excessive beta amyloid (Aβ) deposition in brain, leading to blood-brain barrier (BBB) disruption. The mechanisms of BBB disruption in AD are still unclear, despite considerable research. The adipokine adiponectin
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.