설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCTAATCCATGGGGAGGTCCTGGGGAAGGGCTTCTTTGGGCAGGCTATCAAGGTGACACACAAAGCCACGGGCAAAGTGATGGTCATGAAAGAGTTAATTCGATGTGATGAGGAGACCCAGAAAACTTTTCTGACTGAGGTGAAAGTGATGCGCAGCCTGGACCACCCCAATGTGCTCAAGTTCATTGGTGTGCTGTACAAGGATAAGAAGCTGAACCTCCTGACAGAGTACATTGAGGGGGGCACACTGAAGGACTTTCTGCGCAGTATGGATCCGTTCCCCTGGCAGCAGAAGGTCAGGTTTGCCAAAGGAATCGCCTCCGGAATGGCCTATTTGCACTCTATGTGCATCATCCACCGGGATCTGAACTCGCACAACTGCCTCATCAAGTTGGACAAGACTGTGGTGGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LIMK2(3985), LIMK2(3985)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Wei Wang et al.
International journal of cancer, 144(6), 1345-1355 (2018-07-15)
LIM kinases modulate multiple aspects of cancer development, including cell proliferation and survival. As the mechanisms of LIMK-associated tumorigenesis are still unclear, we analyzed the tumorigenic functions of LIM kinase 2 (LIMK2) in human bladder cancer (BC) and explored whether
Xing Duan et al.
Journal of cellular physiology, 233(8), 6088-6097 (2018-01-11)
LIM kinases (LIMK1/2) are LIM domain-containing serine/threonine/tyrosine kinases that mediate multiple cellular processes in mitosis. In the present study, we explored the functional roles and potential signaling pathway of LIMK1/2 during mouse oocyte meiosis. Disruption of LIMK1/2 activity and expression
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.