콘텐츠로 건너뛰기
Merck

EHU145491

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2D

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCACTGCCTACAACACAGATTACCAGTTGACCAGTGCAGAGCTCTCCTCCTTACCAGCCTTTAGTTCACCTGGGGGGCTGTCGCTAGGCAATGTCACTGCCTGGCAACAGCCACAGCAGCCCCAGCAGCCGCAGCAGCCACAGCCTCCACAGCAGCAGCCACCGCAGCCACAGCAGCCACAGCCACAGCAGCCTCAGCAGCCGCAACAGCCACCTCAGCAACAGTCCCACCTGGTCCCTGTATCTCTCAGCAACCTCATCCCGGGCAGCCCCCTGCCCCACGTGGGTGCTGCCCTCACAGTCACCACCCACCCCCACATCAGCATCAAGTCAGAACCGGTGTCCCCAAGCCGTGAGCGCAGCCCTGCGCCTCCCCCTCCAGCTGTGTTCCCAGCTGCCCGCCCTGAGCCTGGCGATGGTCTCAGCAGCCCAGCCGGGGGATCCTATGAGACGGGAGACCGGGATGACGGACGGGGGGACTTCGGGCCCACACTGGGCCTGCTGCGCCCAGCCCCAGAGCCTGAGGCTGAGGGCTCAGCTGTGAAGAGGATGCGGCTTGATA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shuna Li et al.
Aging, 12(7), 6456-6466 (2020-04-10)
Cochlear ribbon synapses play a pivotal role in the prompt and precise acoustic signal transmission from inner hair cells (IHCs) to the spiral ganglion neurons, while noise and aging can damage ribbon synapses, resulting in sensorineural hearing loss. Recently, we
Zhi-Qin Hu et al.
Oncotarget, 8(54), 92079-92089 (2017-12-02)
The role of microRNA-92b-3p (miR-92b-3p) in cardiac hypertrophy was not well illustrated. The present study aimed to investigate the expression and potential target of miR-92b-3p in angiotensin II (Ang-II)-induced mouse cardiac hypertrophy. MiR-92b-3p was markedly decreased in the myocardium of
Haiyun Chen et al.
Aging, 12(14), 14897-14917 (2020-07-28)
T-006, a new derivative of tetramethylpyrazine, has been recently found to protect against 6-hydroxydopamine (6-OHDA)-induced neuronal damage and clear α-synuclein (α-syn) by enhancing proteasome activity in an α-syn transgenic Parkinson's disease (PD) model. The effect of T-006 on the 1-methyl-4-phenyl-1
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.