설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GATA3(2625), GATA3(2625)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Mei Xu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(11), 3605-3617 (2018-09-27)
p38γ is a member of p38 MAPK family which contains four isoforms p38α, p38β, p38γ, and p38δ. p38γ MAPK has unique function and is less investigated. Recent studies revealed that p38γ MAPK may be involved in tumorigenesis and cancer aggressiveness.
P Shahi et al.
Oncogene, 36(40), 5567-5575 (2017-06-06)
Semaphorin 3B (SEMA3B) is a secreted axonal guidance molecule that is expressed during development and throughout adulthood. Recently, SEMA3B has emerged as a tumor suppressor in non-neuronal cells. Here, we show that SEMA3B is a direct target of GATA3 transcriptional
Shuangqin Wei et al.
Cancer management and research, 9, 769-780 (2017-12-22)
GATA3, a member of the GATA zinc finger transcription factor family, has been widely investigated for its role in cancer. Although a recent report has found that GATA3 is downregulated in gastric cancer (GC), the detailed mechanism of GATA3 in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.