설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAAGATGGGACAGCGGATTACCATAGCAACGGCTATACCGTCACCAACGGCTGGAAGATCCACAACACGGCCAAGAATAAGTGGTTTGTCTGCATGGCCAAGACGGCAGAGGAGAAGCAGAAGTGGCTGGATGCCATCATCCGCGAGCGGGAGCAGCGCGAGAGCCTGAAGCTGGGCATGGAGCGTGATGCCTACGTCATGATTGCGGAGAAGGGGGAGAAGCTGTACCACATGATGATGAACAAGAAGGTGAACCTCATCAAGGACCGCCGGAGAAAGCTGAGCACTGTCCCCAAGTGCTTTCTTGGCAATGAGTTCGTTGCCTGGCTCCTAGAAATTGGTGAAATCAGCAAGACGGAAGAAGGAGTCAACTTGGGCCAAGCCCTGTTGGAGAATGGCATCATCCACCATGTTTCCGACAAGCACCAGTTCAAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PREX1(57580), PREX1(57580)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jinhua Wang et al.
Cancer letters, 407, 66-75 (2017-08-15)
P-REX1 (PIP3-dependent Rac exchange factor-1) is a guanine nucleotide exchange factor that activates Rac by catalyzing exchange of GDP for GTP bound to Rac. Aberrant up-regulation of P-REX1 expression has a role in metastasis however, copy number (CN) and function
Nimisha R Kumar et al.
Scientific reports, 9(1), 16980-16980 (2019-11-20)
Molecular factors altered in corneas that develop haze post refractive surgery have been described, but pre-existing factors that predispose clinically normal corneas to aberrant fibrosis post surgery and the role of the corneal epithelium remains unknown. We analyzed the global gene
L M Dillon et al.
Oncogene, 34(30), 3968-3976 (2014-10-07)
Phosphatidylinositol 3-kinase (PI3K) promotes cancer cell survival, migration, growth and proliferation by generating phosphatidylinositol 3,4,5-trisphosphate (PIP3) in the inner leaflet of the plasma membrane. PIP3 recruits pleckstrin homology domain-containing proteins to the membrane to activate oncogenic signaling cascades. Anticancer therapeutics
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.