콘텐츠로 건너뛰기
Merck

EHU127401

Sigma-Aldrich

MISSION® esiRNA

targeting human BRAF

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BRAF(673), BRAF(673)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nicholes R Candelaria et al.
PloS one, 10(12), e0145061-e0145061 (2015-12-15)
Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease
Samantha K McCarty et al.
Endocrine-related cancer, 21(6), 865-877 (2014-09-18)
Increased p21-activated kinase (PAK) signaling and expression have been identified in the invasive fronts of aggressive papillary thyroid cancers (PTCs), including those with RET/PTC, BRAFV600E, and mutant RAS expression. Functionally, thyroid cancer cell motility in vitro is dependent on group
Xin Zhang et al.
The EMBO journal, 38(15), e100871-e100871 (2019-07-16)
Reactive oxygen species (ROS) are emerging as important regulators of cancer growth and metastatic spread. However, how cells integrate redox signals to affect cancer progression is not fully understood. Mitochondria are cellular redox hubs, which are highly regulated by interactions
Hitoshi Sase et al.
Molecular cancer therapeutics, 17(10), 2217-2225 (2018-07-27)
FGFR2 gene is frequently amplified in gastric cancer. Recently, targeting FGFR2 has drawn attention as a form of gastric cancer therapy, and FGFR-selective inhibitors have shown promising efficacy in clinical studies. Because overcoming acquired resistance is a common problem with
Cindy Kundlacz et al.
Journal of virology, 93(16) (2019-06-07)
Bluetongue virus (BTV) is an arbovirus transmitted by blood-feeding midges to a wide range of wild and domestic ruminants. In this report, we showed that BTV, through its nonstructural protein NS3 (BTV-NS3), is able to activate the mitogen-activated protein kinase/extracellular

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.