콘텐츠로 건너뛰기
Merck

EHU125021

Sigma-Aldrich

MISSION® esiRNA

targeting human GYPC

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACGGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAGGAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCATCTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCAGAGCTAAAAGG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie Liu et al.
Hepatology (Baltimore, Md.), 69(4), 1535-1548 (2018-12-07)
Endocannabinoids promote energy conservation in obesity, whereas cannabinoid-1 receptor (CB1 R) blockade reverses body weight gain and insulin resistance and increases energy expenditure. Here we investigated the molecular mechanisms of the catabolic effects of CB1 R blockade in the liver.
Weiwei Cheng et al.
Neuron, 104(5), 885-898 (2019-10-08)
Hexanucleotide GGGGCC repeat expansion in C9ORF72 is the most prevalent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). One pathogenic mechanism is the aberrant accumulation of dipeptide repeat (DPR) proteins produced by the unconventional translation of expanded RNA repeats.
Charles A Berdan et al.
Cell chemical biology, 26(7), 1027-1035 (2019-05-14)
Parthenolide, a natural product from the feverfew plant and member of the large family of sesquiterpene lactones, exerts multiple biological and therapeutic activities including anti-inflammatory and anti-cancer effects. Here, we further study the parthenolide mechanism of action using activity-based protein
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.