설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAGGAATGACAAAGCTTGCTTTTCTGGTATGTTCTAGGTGTATTGTGACTTTTACTGTTATATTAATTGCCAATATAAGTAAATATAGATTATATATGTATAGTGTTTCACAAAGCTTAGACCTTTACCTTCCAGCCACCCCACAGTGCTTGATATTTCAGAGTCAGTCATTGGTTATACATGTGTAGTTCCAAAGCACATAAGCTAGAAGAAGAAATATTTCTAGGAGCACTACCATCTGTTTTCAACATGAAATGCCACACACATAGAACTCCAACATCAATTTCATTGCACAGACTGACTGTAGTTAATTTTGTCACAGAATCTATGGACTGAATCTAATGCTTCCAAAAATGTTGTTTGTTTGCAAATATCAAACATTGTTATGCAAGAAATTATTAATTACAAAATGAAGATTTATACCATTGTGGTTTAAGCTGTACTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RTN4(57142), RTN4(57142)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jin-Kyu Park et al.
Hepatology (Baltimore, Md.), 65(5), 1720-1734 (2017-01-17)
Nogo-B (Reticulon 4B) is an endoplasmic reticulum (ER) resident protein that regulates ER structure and function. Because ER stress is known to induce M2 macrophage polarization, we examined whether Nogo-B regulates M1/M2 polarization of Kupffer cells and alters the pathogenesis
Yu-Jie Chen et al.
The Journal of cell biology, 219(2) (2020-01-03)
Escape of large macromolecular complexes from the endoplasmic reticulum (ER), such as a viral particle or cellular aggregate, likely induces mechanical stress initiated on the luminal side of the ER membrane, which may threaten its integrity. How the ER responds
Jiajia Cui et al.
Journal of controlled release : official journal of the Controlled Release Society, 304, 259-267 (2019-05-06)
Degradable poly(amine-co-ester) (PACE) terpolymers hold tremendous promise for siRNA delivery because these materials can be formulated into delivery vehicles with highly efficient siRNA encapsulation, providing effective knockdown with low toxicity. Here, we demonstrate that PACE nanoparticles (NPs) provide substantial protein
Dae-Gyun Ahn et al.
Cell cycle (Georgetown, Tex.), 14(14), 2301-2310 (2015-05-07)
Dysregulation of Ras signaling is the major cause of various cancers. Aberrant Ras signaling, however, provides a favorable environment for many viruses, making them suitable candidates as cancer-killing therapeutic agents. Susceptibility of cancer cells to such viruses is mainly due
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.