설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TPT1(7178), TPT1(7178)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
siRNA targeting TCTP suppresses osteosarcoma cell growth and induces apoptosis in vitro and in vivo.
Jian-Hui Shen et al.
Biotechnology and applied biochemistry, 63(1), 5-14 (2014-12-20)
Osteosarcoma (OS) remains the most frequent primary malignant bone tumor in adolescents. However, the molecular cause of the disease is poorly elucidated. In the present study, we primarily found that translationally controlled tumor protein (TCTP) was overexpressed in human OS
Mari Kaarbø et al.
PloS one, 8(7), e69398-e69398 (2013-07-31)
TCTP has been implicated in a plethora of important cellular processes related to cell growth, cell cycle progression, malignant transformation and inhibition of apoptosis. In addition to these intracellular functions, TCTP has extracellular functions and plays an important role in
Seong-Yeon Bae et al.
Scientific reports, 5, 8061-8061 (2015-01-28)
Translationally controlled tumor protein (TCTP), is a highly conserved protein involved in fundamental processes, such as cell proliferation and growth, tumorigenesis, apoptosis, pluripotency, and cell cycle regulation. TCTP also inhibits Na,K-ATPase whose subunits have been suggested as a marker of
Ruilin Sun et al.
OncoTargets and therapy, 12, 1641-1653 (2019-03-19)
Lung cancer is the most common and lethal malignancy worldwide. TCTP is highly expressed in various cancers including lung cancer. Epithelial-mesenchymal transition (EMT) could increase cancer cell invasion. Whether TCTP's expression is associated with EMT in lung adenocarcinoma is largely
Yu You et al.
Journal of Cancer, 8(14), 2854-2865 (2017-09-21)
MicroRNAs (miRNAs) are increasingly recognized as being involved in pancreatic cancer progression by directly regulating the expression of their targets. In this study, we showed that miR-216b-5p expression was significantly decreased in pancreatic cancer tissues and cell lines. In addition
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.