설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MDM2(4193), MDM2(4193)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Bin Zhang et al.
Oncotarget, 8(42), 71894-71910 (2017-10-27)
Growing evidence indicates that 14-3-3ζ and yes-associated protein (YAP) substantially promote tumorigenesis and tumor development. However, the regulatory mechanism underlying these two proteins remains unknown. Herein, we report a new regulatory role of 14-3-3ζ in the phosphorylation of YAP and
Chengtao Sun et al.
OncoTargets and therapy, 13, 10475-10487 (2020-10-30)
Cell-division cycle 20 (CDC20) is overexpressed in a variety of tumor cells and is negatively regulated by wild-type p53 (wtp53). Our previous study uncovered that CDC20 was upregulated and associated with poor outcome in diffuse large B-cell lymphoma (DLBCL) based
Yong Tang et al.
OncoTargets and therapy, 12, 2247-2258 (2019-04-17)
Mouse double minute 2 (MDM2) contributes to cancer metastasis and epithelial-mesenchymal transition (EMT). This study aimed to investigate small mothers against decapentaplegic (Smad) signaling in MDM2-mediated EMT in lung adenocarcinoma (LAC). Expression patterns of MDM2 in LAC tissues, adjacent tissues
Lingxin Meng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 139-145 (2018-08-08)
Vascular endothelial growth factor (VEGF) signaling promotes angiogenesis by stimulating the migration and proliferation of endothelial cells. The aim of this study was to investigate the expression of Survivin and VEGF receptor 1/2/3 (VEGFR 1/2/3) in esophageal carcinoma tissues (ECTs)
Hao Zhao et al.
Inflammation, 40(1), 232-239 (2016-11-14)
Inflammation has been implicated in myocardial infarction (MI). MDM2 associates with nuclear factor-κB (NF-κB)-mediated inflammation. However, the role of MDM2 in MI remains unclear. This study aimed to evaluate the impacts of MDM2 inhibition on cardiac dysfunction and fibrosis after
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.