설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Rui Jiang et al.
International immunopharmacology, 69, 373-381 (2019-02-19)
Kaempferol is a kind of bioflavonoid exerts diverse pharmacological activities, including anti-apoptotic and anti-inflammatory activities. Kaempferol has been recognized as an effective agent for alleviating the clinical symptoms of osteoarthritis (OA). This study aimed to provide evidence that Kaempferol has
Yoshihiro Joshua Ono et al.
The Journal of endocrinology, 223(2), 203-216 (2014-09-24)
Dienogest, a synthetic progestin, has been shown to be effective against endometriosis, although it is still unclear as to how it affects the ectopic endometrial cells. Decorin has been shown to be a powerful endogenous tumor repressor acting in a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.