설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGAATCCCTCATTGACGAAGAGGTAATCTACAGTGAGCTGATGAGTGACTTTGAGATGGATGAGAAGGACTTTGCAGCTGACTCTTGGAGTCTTGCTGTGGACAGCAGCTTCCTGCAGCAGCATAAAAAGGAGGTGATGAAGCAGCAAGATGTCATCTATGAGCTAATCCAGACAGAGCTGCACCATGTGAGGACACTGAAGATCATGACCCGCCTCTTCCGCACGGGGATGCTGGAAGAGCTACACTTGGAGCCAGGAGTGGTCCAGGGCCTGTTCCCCTGCGTGGACGAGCTCAGTGACATCCATACACGCTTCCTCAGCCAGCTATTAGAACGCCGACGCCAGGCCCTGTGCCCTGGCAGCACCCGGAACTTTGTCATCCATCGCTTGGGTGATCTGCTCATCAGCCAGTTCTCAGGTCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ARHGEF2(9181), ARHGEF2(9181)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Juan José Sáez et al.
The Journal of cell biology, 218(7), 2247-2264 (2019-06-15)
B lymphocytes capture antigens from the surface of presenting cells by forming an immune synapse. Local secretion of lysosomes, which are guided to the synaptic membrane by centrosome repositioning, can facilitate the extraction of immobilized antigens. However, the molecular basis
Tony Y-C Tsai et al.
Developmental cell, 49(2), 189-205 (2019-04-25)
Efficient chemotaxis requires rapid coordination between different parts of the cell in response to changing directional cues. Here, we investigate the mechanism of front-rear coordination in chemotactic neutrophils. We find that changes in the protrusion rate at the cell front
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.