콘텐츠로 건너뛰기
Merck

EHU089751

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX2

로그인조직 및 계약 가격 보기

크기 선택

제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGC

Ensembl | 인체 수납 번호

ENSG00000124813

NCBI 수납 번호

NM_004348

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RUNX2(860), RUNX2(860)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ISS
XPS
QIS
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Uwe Raaz et al.
Circulation research, 117(6), 513-524 (2015-07-26)
Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date. The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target
Engin Kaptan et al.
Journal of cellular biochemistry, 118(11), 3911-3919 (2017-04-09)
Runx2 promotes metastatic ability of cancer cells by directly activating some of the mediators regarding malignancy. Galectin-3 (Gal-3) extensively expressed in normal and transformed cells and it is responsible for many cellular processes. In this study, we aimed to investigate
Chen-Ling Zhang et al.
Biochemical and biophysical research communications, 482(4), 1469-1476 (2016-12-15)
Deregulation of epigenetic modification by microRNAs (miRNAs) contributes to the development of estrogen deficiency, a hallmark of the multigenic endocrine disorder polycystic ovary syndrome (PCOS), but its etiology remains unclear. Previous study has pointed to a tight association between miR-320a
Mingkun Han et al.
OncoTargets and therapy, 11, 6305-6316 (2018-10-16)
It was previously reported that downregulation of miR-218 promoted thyroid cancer cell invasion, migration, and proliferation. However, the biological functions of miR-218 and its possible regulatory mechanisms in papillary thyroid cancer (PTC) cells are still elusive. The expression levels of
Rajnee Kanwal et al.
Cancer letters, 430, 25-33 (2018-05-19)
The role of CD133 (Prominin-1) as a cancer stem cell marker may be useful for therapeutic approaches and prognostication in prostate cancer patients. We investigated the stem-cell-related function and biological features of a subpopulation of CD133+ cells isolated from established primary
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.