콘텐츠로 건너뛰기
Merck

EHU088121

Sigma-Aldrich

MISSION® esiRNA

targeting human PTBP1

로그인조직 및 계약 가격 보기

크기 선택

제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG

Ensembl | 인체 수납 번호

ENSG00000011304

NCBI 수납 번호

NM_031991

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PTBP1(5725), PTBP1(5725)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BEU
KCU
IZT
XST
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chun-Yu Cho et al.
Scientific reports, 9(1), 16922-16922 (2019-11-16)
AXL is expressed in many types of cancer and promotes cancer cell survival, metastasis and drug resistance. Here, we focus on identifying modulators that regulate AXL at the mRNA level. We have previously observed that the AXL promoter activity is
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Aline Marnef et al.
Nucleic acids research, 44(3), 1342-1353 (2015-12-15)
Human polypyrimidine tract-binding protein PTB is a multifunctional RNA-binding protein with four RNA recognition motifs (RRM1 to RRM4). PTB is a nucleocytoplasmic shuttle protein that functions as a key regulator of alternative pre-mRNA splicing in the nucleoplasm and promotes internal
Mohamed Sham Shihabudeen Haider Ali et al.
Nucleic acids research, 47(3), 1505-1522 (2018-11-27)
The role of long non-coding RNAs (lncRNAs) in regulating endothelial function through the DNA damage response (DDR) remains poorly understood. In this study, we demonstrate that lncRNA maternally expressed gene 3 (Meg3) interacts with the RNA binding protein polypyrimidine tract
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.