설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCTGCTGGACTTCCTCATCAAGTCCTCATTCATTGGAGTATCTGGAGAGGAGGTGTGGTTTGATGAGAAAGGAGACGCTCCTGGAAGGTATGATATCATGAATCTGCAGTACACTGAAGCTAATCGCTATGACTATGTGCACGTTGGAACCTGGCATGAAGGAGTGCTGAACATTGATGATTACAAAATCCAGATGAACAAGAGTGGAGTGGTGCGGTCTGTGTGCAGTGAGCCTTGCTTAAAGGGCCAGATTAAGGTTATACGGAAAGGAGAAGTGAGCTGCTGCTGGATTTGCACGGCCTGCAAAGAGAATGAATATGTGCAAGATGAGTTCACCTGCAAAGCTTGTGACTTGGGATGGTGGCCCAATGCAGATCTAACAGGCTGTGAGCCCATTCCTGTGCGCTATCTTGAGTGGAGCAACATCGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GRM1(2911), GRM1(2911)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Rachel E Sexton et al.
Scientific reports, 8(1), 16008-16008 (2018-10-31)
Breast cancer remains a major cause of death among women. 15% of these cancers are triple negative breast cancer (TNBC), an aggressive subtype of breast cancer for which no current effective targeted therapy exists. We have previously demonstrated a role
Mohanan Valiya Veettil et al.
PLoS pathogens, 10(10), e1004389-e1004389 (2014-10-10)
Kaposi's sarcoma associated herpesvirus (KSHV) is etiologically associated with endothelial Kaposi's sarcoma (KS) and B-cell proliferative primary effusion lymphoma (PEL), common malignancies seen in immunocompromised HIV-1 infected patients. The progression of these cancers occurs by the proliferation of cells latently
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.