설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCACCTTAGGTCCCTTTGGAAACATTCCATTTGACTTTTCCCTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCATTGCACAAGCTCCTTTGCTTTTAGTGTTACCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGAACATGCTCTAACTGGCCTGTGCTACTTATTACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACTCACCTTTCTGCTGCCCTCTTCATGCAGGCCTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGCCTGACGCCACAGTCATTGGCAGAGGTCTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PLEKHA7(144100), PLEKHA7(144100)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Antonis Kourtidis et al.
Nature cell biology, 17(9), 1145-1157 (2015-08-25)
E-cadherin and p120 catenin (p120) are essential for epithelial homeostasis, but can also exert pro-tumorigenic activities. Here, we resolve this apparent paradox by identifying two spatially and functionally distinct junctional complexes in non-transformed polarized epithelial cells: one growth suppressing at
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.