설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTGGCTCGATGCCTAAGATGGGGAGGAGGTTATGAAGGACAGAATCTGGCAAAGATCCTCAAGGATTTAGAGATGAGTAAAGTGGTACATATGGATCGATGGTCTGTGGAGGTGATACCTCAACAAACTGAAGAAAAAAGTGACCCAGTCCCCTTTCAAATCATCAATAACTACTTCTCTATTGGCGTGGATGCCTCTATTGCTCATCGATTCCACATCATGCGAGAGAAATATCCGGAGAAGTTCAACAGCAGAATGAAGAACAAGCTATGGTACTTCGAATTTGCCACATCTGAATCCATCTTCTCAACATGCAAAAAGCTGGAGGAGTCTTTGACAGTTGAGATCTGTGGGAAACCGCTGGATCTGAGCAACCTGTCCCTAGAAGGCATCGCAGTGCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DGKA(1606), DGKA(1606)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Inan Olmez et al.
Neuro-oncology, 20(2), 192-202 (2017-10-20)
The mesenchymal phenotype in glioblastoma (GBM) and other cancers drives aggressiveness and treatment resistance, leading to therapeutic failure and recurrence of disease. Currently, there is no successful treatment option available against the mesenchymal phenotype. We classified patient-derived GBM stem cell
Jie Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(14), 3843-3855 (2020-04-29)
Although platinum compounds are the first-line treatment for ovarian cancer, the majority of patients relapse and develop resistance to treatment. However, the mechanism underlying resistance is unclear. The goal of our study is to decipher the mechanism by which a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.