콘텐츠로 건너뛰기
Merck

EHU075571

Sigma-Aldrich

MISSION® esiRNA

targeting human TSLP

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAAACCATCTTTATTATGGTCATATTTCACAGCACCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chenyang Dai et al.
Experimental eye research, 182, 19-29 (2019-03-12)
Thymic stromal lymphopoietin (TSLP) is an interleukin 7 (IL-7)-like four helix bundle cytokine that plays diverse roles in the regulation of immune responses. In fungal infection, pattern recognition receptors (PRRs), including the cell surface Toll-like receptors (TLRs) and cytoplasmic NOD-like
Gaoshun Ni et al.
Cellular immunology, 312, 35-41 (2016-11-28)
The newly discovered intracytosolic pattern recognition receptor nucleotide-binding oligomerization domain 2 (NOD2) has been studied as an important indicator of T helper 2 (Th2) inflammation, and its effect on regulatory T (Treg) cells is likely to modulate the immune response.
Na-Ra Han et al.
Journal of clinical medicine, 8(9) (2019-09-05)
Thymic stromal lymphopoietin (TSLP) is crucial for Th2-mediated inflammation. Sepsis is a serious systemic inflammatory reaction with organ dysfunction by infection. However, the function of TSLP during sepsis is poorly understood. Thus, we investigated a role and regulatory mechanism of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.