설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAAACCATCTTTATTATGGTCATATTTCACAGCACCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TSLP(85480), TSLP(85480)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Chenyang Dai et al.
Experimental eye research, 182, 19-29 (2019-03-12)
Thymic stromal lymphopoietin (TSLP) is an interleukin 7 (IL-7)-like four helix bundle cytokine that plays diverse roles in the regulation of immune responses. In fungal infection, pattern recognition receptors (PRRs), including the cell surface Toll-like receptors (TLRs) and cytoplasmic NOD-like
Gaoshun Ni et al.
Cellular immunology, 312, 35-41 (2016-11-28)
The newly discovered intracytosolic pattern recognition receptor nucleotide-binding oligomerization domain 2 (NOD2) has been studied as an important indicator of T helper 2 (Th2) inflammation, and its effect on regulatory T (Treg) cells is likely to modulate the immune response.
Na-Ra Han et al.
Journal of clinical medicine, 8(9) (2019-09-05)
Thymic stromal lymphopoietin (TSLP) is crucial for Th2-mediated inflammation. Sepsis is a serious systemic inflammatory reaction with organ dysfunction by infection. However, the function of TSLP during sepsis is poorly understood. Thus, we investigated a role and regulatory mechanism of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.