설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAGGAAAGGGATTTGCTTCCAGGGAGAACAGGCGTAATAATGGGTTATCTGGGAAATGTTTGCAAGAGGCTCAAGAAGAAGGGAATTCCATATTGCCTGAAAGAAGAGGAAGACCAGAAATCTCTTTAGATGAAAGAGGAGAAGGAGGACATGTGCATACTTCTGATGACTCAGAAGTTGTATTTTCTTCTTGTGATTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTAGTGGTCATGCCCCAGAAATTGTGTCTACAGTTCATGAAGATTATTCTGGCTCTTCTGAAAGTTCAAATGATGAAAGTGATTCAGAAGATACAGATTCGGATGATAGCAGTATTCCAAGAAACCGTCTCCAGTCTGTTGTGGTTGTGCCAAAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human  ...  SETD2(29072),   SETD2(29072)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
You Zhou et al.
Aging, 12(24), 25189-25206 (2020-11-24)
The histone H3 lysine 36 methyltransferase SET-domain-containing 2 (SETD2) has been reported to be frequently mutated or deleted in many types of human cancer. However, the role of SETD2 in lung adenocarcinoma (LUAD) has not been well documented. In the
Na Liu et al.
Oncology reports, 32(6), 2397-2404 (2014-10-22)
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.