설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EPHA2(1969), EPHA2(1969)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hee Sung Kim et al.
Scientific reports, 9(1), 3414-3414 (2019-03-06)
Genetically deregulated tumor cells generate vascular channels by vasculogenic mimicry (VM) that is independent of endothelial blood vessels. The morphological characteristics of VM and the role of EphA2 in the formation of VM were evaluated in 144 clinical samples of
Qiaoli Wu et al.
Biochemical and biophysical research communications, 503(4), 2436-2442 (2018-07-04)
MiR-124-3p and EphA2 are aberrantly expressed in glioma tissue specimens. In the present study, we firstly investigated that miR-124-3p inhibits EphA2 expression mediated by binding its 3'-UTR to regulate the progression of human glioma. The U87MG and LN229 cells were transfected
Xin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5495-5509 (2019-01-23)
The balance of myogenic and adipogenic differentiation is crucial for skeletal muscle homeostasis. Given the vital role of membrane proteins (MBPs) in cell signal perception, membrane proteomics was conducted to delineate mechanisms regulating differentiation of adipogenic and myogenic precursors in
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Marc Swidergall et al.
PLoS pathogens, 17(1), e1009221-e1009221 (2021-01-21)
During oropharyngeal candidiasis (OPC), Candida albicans invades and damages oral epithelial cells, which respond by producing proinflammatory mediators that recruit phagocytes to foci of infection. The ephrin type-A receptor 2 (EphA2) detects β-glucan and plays a central role in stimulating
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.