설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTTTAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCTTCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TFCP2(7024), TFCP2(7024)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Shi Wang et al.
Acta biochimica et biophysica Sinica, 48(12), 1085-1093 (2016-11-01)
Pancreatic cancer is an aggressive malignancy. The median survival rate remains low, indicating that the identification of novel biomarkers and therapeutic targets is critical. Here, we examined the role of microRNA-182 (miR-182) in pancreatic cancer development. Analysis of human pancreatic
Kedarlal Sharma et al.
Journal of molecular neuroscience : MN, 65(3), 343-350 (2018-07-12)
MeCP2 (methyl-CpG binding protein 2), an epigenetic regulator, has been shown to regulate the function of neurons and glial cells. Our previous study has demonstrated that MeCP2 repress the myelin gene expression in rat oligodendrocytes but whether MeCP2 bind to
Arpita Dave et al.
Journal of molecular neuroscience : MN, 67(1), 16-27 (2018-12-07)
Astrocytes play the central role in CNS metabolism to support neuronal functions. Mehyl-CpG-binding protein 2 (MeCP2) is the global transcription factor with differential expression in neuronal and non-neuronal cells. MeCP2 mutation and downstream detrimental effects have been reported in astrocytes
Jiawei Zhou et al.
Cell death & disease, 8(2), e2597-e2597 (2017-02-10)
Mammalian folliculogenesis is a complex process in which primordial follicles develop into pre-ovulatory follicles, followed by ovulation to release mature oocytes. In this study, we explored the role of miR-144 in ovulation. miR-144 was one of the differentially expressed microRNAs
Buch Lipi et al.
Experimental brain research, 236(11), 3015-3027 (2018-08-18)
Astrocytes perform several critical functions such as promoting neuronal maturation, neuronal survival, maintaining and supporting neurons and oligodendrocytes. Astrocytes participate in the formation of nodes of Ranvier. Recently, studies emphasizing on the role of astrocytes in regulating myelination by secreting
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.