설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGGGGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGCATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAGTGTGAAGACTGCGGCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PRKCD(5580), PRKCD(5580)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Markus Dietrich et al.
Experimental cell research, 382(2), 111473-111473 (2019-06-25)
ErbB3, which belongs to the epidermal growth factor receptor (EGFR) or ErbB family of receptor tyrosine kinases, is involved in progression of several human cancers and a tight regulation of its expression is crucial. An important mechanism for regulation of
Sara G Pollan et al.
Oncogene, 37(21), 2817-2836 (2018-03-08)
Tumor metastasis depends on the dynamic regulation of cell adhesion through β1-integrin. The Cub-Domain Containing Protein-1, CDCP1, is a transmembrane glycoprotein which regulates cell adhesion. Overexpression and loss of CDCP1 have been observed in the same cancer types to promote
Zoé Lama et al.
Antiviral research, 168, 51-60 (2019-05-10)
Rabies virus (RABV) is a neurotropic virus that causes fatal encephalitis in humans and animals and still kills up to 59,000 people worldwide every year. To date, only preventive or post-exposure vaccination protects against the disease but therapeutics are missing.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.