콘텐츠로 건너뛰기
Merck

EHU062091

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIA

로그인조직 및 계약 가격 보기

크기 선택

제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGTTCTTTCCAACCCAGACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGATAAAGTCTGGAGGTTGGACCTTGTTATGGTGATTTTGTTTAAAGGTATTCCGCTGGAAAGTACTGATGGCGAGCGCCTTGTAAAGTCCCCACAATGCTCTAATCCAGGGCTCTGTGTCCAACCCCATCACATAGGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCAAGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAATGGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTCACTGAGCTAGTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCAAATTTTTCTCTCTCAGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAAT

Ensembl | 인체 수납 번호

ENSG00000162599

NCBI 수납 번호

NM_005595

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NFIA(4774), NFIA(4774)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chin-Cheng Lee et al.
PloS one, 12(3), e0173890-e0173890 (2017-03-23)
MicroRNAs are small noncoding RNAs that post-transcriptionally control the expression of genes involved in glioblastoma multiforme (GBM) development. Although miR-302b functions as a tumor suppressor, its role in GBM is still unclear. Therefore, this study comprehensively explored the roles of
Hairui Yuan et al.
Journal of cellular physiology, 236(3), 1810-1821 (2020-07-24)
miR-142a-5p plays critical roles in multiple biological processes and diseases, such as inflammation and tumorigenesis. However, it remains to be explored if and how miR-142a-5p contributes to osteoblast differentiation. In this study, our results showed that miR-142a-5p was highly expressed
Wenxiang Hu et al.
Cell stem cell, 24(2), 299-308 (2019-01-15)
Thiazolidinedione drugs (TZDs) target the transcriptional activity of peroxisome proliferator activated receptor γ (PPARγ) to reverse insulin resistance in type 2 diabetes, but side effects limit their clinical use. Here, using human adipose stem cell-derived adipocytes, we demonstrate that SNPs
Motoshi Nagao et al.
Nature communications, 7, 11102-11102 (2016-03-24)
Multipotent neural precursor cells (NPCs) generate astrocytes at late stages of mammalian neocortical development. Many signalling pathways that regulate astrocytogenesis directly induce the expression of GFAP, a marker of terminally differentiated astrocytes. However, astrocyte specification occurs before GFAP expression and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.