설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGTTCTTTCCAACCCAGACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGATAAAGTCTGGAGGTTGGACCTTGTTATGGTGATTTTGTTTAAAGGTATTCCGCTGGAAAGTACTGATGGCGAGCGCCTTGTAAAGTCCCCACAATGCTCTAATCCAGGGCTCTGTGTCCAACCCCATCACATAGGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCAAGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAATGGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTCACTGAGCTAGTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCAAATTTTTCTCTCTCAGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human  ...  NFIA(4774),   NFIA(4774)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Chin-Cheng Lee et al.
PloS one, 12(3), e0173890-e0173890 (2017-03-23)
MicroRNAs are small noncoding RNAs that post-transcriptionally control the expression of genes involved in glioblastoma multiforme (GBM) development. Although miR-302b functions as a tumor suppressor, its role in GBM is still unclear. Therefore, this study comprehensively explored the roles of
Hairui Yuan et al.
Journal of cellular physiology, 236(3), 1810-1821 (2020-07-24)
miR-142a-5p plays critical roles in multiple biological processes and diseases, such as inflammation and tumorigenesis. However, it remains to be explored if and how miR-142a-5p contributes to osteoblast differentiation. In this study, our results showed that miR-142a-5p was highly expressed
Wenxiang Hu et al.
Cell stem cell, 24(2), 299-308 (2019-01-15)
Thiazolidinedione drugs (TZDs) target the transcriptional activity of peroxisome proliferator activated receptor γ (PPARγ) to reverse insulin resistance in type 2 diabetes, but side effects limit their clinical use. Here, using human adipose stem cell-derived adipocytes, we demonstrate that SNPs
Motoshi Nagao et al.
Nature communications, 7, 11102-11102 (2016-03-24)
Multipotent neural precursor cells (NPCs) generate astrocytes at late stages of mammalian neocortical development. Many signalling pathways that regulate astrocytogenesis directly induce the expression of GFAP, a marker of terminally differentiated astrocytes. However, astrocyte specification occurs before GFAP expression and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.