설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCGGACGGAATTACTCCTTGTCTGTGTACCTGGTGAGGCAGTTGACTGCAGGAACCCTTCTACAAAAACTCAGAGCAAAGGGTATCCGGAACCCAGACCACTCGCGGGCACTGATCAAGGAGAAATTGACTGCTGACCCTGACAGTGAGGTGGCCACTACAAGTCTCCGGGTGTCACTCATGTGCCCGCTAGGGAAGATGCGCCTGACTGTCCCTTGTCGTGCCCTCACCTGCGCCCACCTGCAGAGCTTCGATGCTGCCCTTTATCTACAGATGAATGAGAAGAAGCCTACATGGACATGTCCTGTGTGTGACAAGAAGGCTCCCTATGAATCTCTTATCATTGATGGTTTATTTATGGAGATTCTTAGTTCCTGTTCAGATTGTGATGAGATCCAATTCATGGAAGATGGATCCTGGTGCCCAATGAAACCCAAGAAGGAGGCATCTGAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human  ...  PIAS3(10401),   PIAS3(10401)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jeong-Hyeon Ko et al.
Immunopharmacology and immunotoxicology, 38(5), 334-343 (2016-06-22)
Constitutive activation of signal transducer and activator of transcription 3 (STAT3) is frequently observed and closely linked with proliferation, survival, metastasis and angiogenesis of various cancer cells, and thus its inhibition can be considered a potential therapeutic strategy. We found
Jordi Codony-Servat et al.
British journal of cancer, 117(12), 1777-1786 (2017-11-11)
Although chemotherapy is the cornerstone treatment for patients with metastatic colorectal cancer (mCRC), acquired chemoresistance is common and constitutes the main reason for treatment failure. Monoclonal antibodies against insulin-like growth factor-1 receptor (IGF-1R) have been tested in pre-treated mCRC patients
Jeong-Hwan Yoon et al.
Nature communications, 6, 7600-7600 (2015-07-22)
Transforming growth factor-β (TGF-β) and interleukin-6 (IL-6) are the pivotal cytokines to induce IL-17-producing CD4(+) T helper cells (TH17); yet their signalling network remains largely unknown. Here we show that the highly homologous TGF-β receptor-regulated Smads (R-Smads): Smad2 and Smad3
Xiaoyun Dai et al.
Molecular oncology, 9(4), 818-833 (2015-01-28)
Deregulated activation of oncogenic transcription factors such as signal transducer and activator of transcription 3 (STAT3) plays a pivotal role in proliferation and survival of hepatocellular carcinoma (HCC). Thus, agents which can inhibit STAT3 activation may have an enormous potential
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.