설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCTGCCAAGCAGAAGAAAGAAGCAGCAGAAGAGGACATTTATTTCACAGGAGAGAGACTGTGTCTTTGGCACTGATTCACTCAGATTGTCTGGGAAAAGACTAAAGGAACAGGAAGAAATCAGTAGCAAAAATCCTGCTAGATCACCAGTAACTGAAATAAGAACTCACCTTTTAAGTCTTAAATCTGAACTTCCAGATTCTCCAGAACCAGTTACAGAAATTAATGAAGACAGTGTATTAATTCCACCAACTGCCCAACCAGAAAAAGGTGTTGATACATTCCTAAGAAGACCTAATTTCACCAGGGCGACTACAGTTCCTTTACAGACTCTATCAGATAGCGGTAGTAGTCAGCACCTTGAACACATTCCTCCTAAAGGTAGCAGTGAACTTACTACTCACGACCTAAAAAACATTAGATTTACTTCACCTGTAAGTTTGGAGGCACAAGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human  ...  PALB2(79728),   PALB2(79728)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Joris Pauty et al.
Nucleic acids research, 45(5), 2644-2657 (2017-02-06)
One typical mechanism to promote genomic instability, a hallmark of cancer, is to inactivate tumor suppressors, such as PALB2. It has recently been reported that mutations in PALB2 increase the risk of breast cancer by 8-9-fold by age 40 and
Antonis C Antoniou et al.
The New England journal of medicine, 371(6), 497-506 (2014-08-08)
Germline loss-of-function mutations in PALB2 are known to confer a predisposition to breast cancer. However, the lifetime risk of breast cancer that is conferred by such mutations remains unknown. We analyzed the risk of breast cancer among 362 members of
Anar K Murphy et al.
The Journal of cell biology, 206(4), 493-507 (2014-08-13)
Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.