설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGTTCATCCTGATGTGTTGGATGAAAGTTGTATGTTTGAAGTGTCTACTAACCTACCTTTAAGTAAAGATAATGTGTGTAGTGTAGAAAAGAGCAAGCCCTGCGTTTCTTCCATACTTCTTGAAGATCTAGCAGTCTCTTTAACAGTACCATCGCCTCTGAAGTCAGATGGTCATCTCAGTTTTTTAAAGCCTGATATGTCGTCCAGTTCAACTCCTGAAGAAGTCATTAGTGCTCATTTTAGTGAAGATGCCTTACTTGAGGAAGAGGATGCATCTGAGCAAGATATTCATTTAGCTCTGGAGTCTGATAATTCAAGCAGTAAATCAAGTTGTTCTTCTTCCTGGACAAGCCGATCTGTTGCTCCAGGCTTTCAGTACCACCCTAATCTACCTATGCATGCCGTCATAATGGAAAAGTCCAATGATCATTTCATTGTGAAAATACGACGTGCAACACCA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CASP8AP2(9994), CASP8AP2(9994)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Takahiro Hirano et al.
PloS one, 10(7), e0133205-e0133205 (2015-07-25)
Dysregulation of the cell proliferation has been implicated in the pathophysiology of a number of diseases. Cellular senescence limits proliferation of cancer cells, preventing tumorigenesis and restricting tissue damage. However, the role of cellular senescence in proliferative nephritis has not
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.