설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGATTGCAGATTGGTGACCTGGTAAATATAGATCTCGACCTCGAAATTGTACAGTCTTTGCAGCATGGTCATGGAGGATGGACTGATGGAATGTTTGAGACTTTAACTACAACTGGAACTGTTTGTGGCATTGATGAAGATCATGACATTGTAGTACAGTATCCAAGTGGCAATAGGTGGACCTTCAATCCTGCTGTTCTCACTAAAGCGAACATTGTCCGAAGTGGAGATGCTGCTCAGGGTGCAGAAGGAGGCACCTCGCAGTTTCAAGTGGGTGATCTTGTACAAGTTTGTTATGACCTGGAACGAATTAAACTTCTACAAAGAGGACATGGAGAATGGGCTGAAGCGATGCTTCCAACTTTAGGTAAAGTTGGCCGAGTACAACAGATTTATTCAGACAGTGATTTAAAGGTGGAAGTTTGTGGAACATCTTGGACATACAATCCAGCAGCAGTTTCCAAGGTGGCATCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MIB1(57534), MIB1(57534)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yoshihiro Otani et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(10), 2381-2392 (2020-03-07)
To examine the effect of oncolytic herpes simplex virus (oHSV) on NOTCH signaling in central nervous system tumors. Bioluminescence imaging, reverse phase protein array proteomics, fluorescence microscopy, reporter assays, and molecular biology approaches were used to evaluate NOTCH signaling. Orthotopic
Marissa A Scavuzzo et al.
Cell reports, 25(13), 3811-3827 (2018-12-28)
Notch is activated globally in pancreatic progenitors; however, for progenitors to differentiate into endocrine cells, they must escape Notch activation to express Neurogenin-3. Here, we find that the transcription factor nuclear factor I/A (NFIA) promotes endocrine development by regulating Notch
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.