설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAGAAACTTCAGGCAGAACATCCATTCATTCATTCATTGGATTGTATATCATTGTTGCACAATCAGAATTGATAAGCACTGTTCCTCCACTCCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MMP7(4316), MMP7(4316)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Ahmad Ghasemi et al.
Journal of cellular biochemistry, 119(2), 2333-2344 (2017-09-09)
Leptin, an adipokine secreted by adipose tissue, induces cell invasion and metastasis. MMP7 is a member of the matrix metalloproteinase family that plays an important role in cell invasion. Here we evaluate the possible role and underlying mechanism of MMP7
Sojoong Choi et al.
Oncotarget, 6(6), 3874-3886 (2015-02-18)
Because earlier studies showed the cell surface heparan sulfate proteoglycan, syndecan-2, sheds from colon cancer cells in culture, the functional roles of shed syndecan-2 were assessed. A non-cleavable mutant of syndecan-2 in which the Asn148-Leu149 residues were replaced with Asn148-Ile149
Q Zhang et al.
Oncogene, 36(5), 687-699 (2016-07-05)
Chronic inflammation has been associated with a variety of human cancers including prostate cancer. Interleukin-17 (IL-17) is a critical pro-inflammatory cytokine, which has been demonstrated to promote development of prostate cancer, colon cancer, skin cancer, breast cancer, lung cancer and
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.