설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NT5E(4907), NT5E(4907)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jaden S Lee et al.
Virulence, 11(1), 414-429 (2020-05-19)
Cell surface nucleotide-metabolizing enzyme, ectonucleotidase-CD73, has emerged as a central component of the cellular homeostatic-machinery that counterbalances the danger-molecule (extracellular-ATP)-driven proinflammatory response in immune cells. While the importance of CD73 in microbial host fitness and symbiosis is gradually being unraveled
Young Mun Jeong et al.
Cancers, 12(10) (2020-10-23)
CD73 is involved in tumor immune escape and promotes the growth and progression of cancer cells. The functional role of CD73 expression in papillary thyroid carcinoma (PTC) has not yet been established. In 511 patients with PTC, immunohistochemistry for CD73
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Xiao-Yu Shi et al.
Asian Pacific journal of tropical medicine, 7(10), 787-791 (2014-08-19)
To explore the effect of Fibulin-5 expression on cell proliferation and invasion in human gastric cancer patients. Fibulin-5 expression was detected in 56 samples of surgically resected gastric cancer and paired noncancerous tissues using qRT-PCR and immunoblotting. Fibulin-5 was knocked
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.