설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCGCTTCCTCATTCTTTGAATCCGCGGCTCCGCGGTCTTCGGCGTCAGACCAGCCGGAGGAAGCCTGTTTGCAATTTAAGCGGGCTGTGAACGCCCAGGGCCGGCGGGGGCAGGGCCGAGGCGGGCCATTTTGAATAAAGAGGCGTGCCTTCCAGGCAGGCTCTATAAGTGACCGCCGCGGCGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCCCGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGCGGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGCGCGTCATCGACTAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human  ...  ID3(3399)   
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Sachindra et al.
Oncotarget, 8(66), 110166-110175 (2018-01-05)
Adaptive resistance to targeted therapy such as BRAF inhibitors represents in melanoma a major drawback to this otherwise powerful treatment. Some of the underlying molecular mechanisms have recently been described: hyperactivation of the BRAF-MAPK pathway, of the AKT pathway, of
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Jayanta K Das et al.
PloS one, 9(8), e104159-e104159 (2014-08-05)
Microvascular lesions resulting from endothelial cell dysfunction are produced in the brain, lung, kidney, and retina of patients of complex chronic diseases. The environmental and molecular risk factors which may contribute in the development of microvascular damage are unclear. The
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.