설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCCCACAGTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACACCCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAGCCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAATCTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTAGAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAAGTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCATCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SOS1(6654), SOS1(6654)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Manish Mishra et al.
Antioxidants & redox signaling, 30(13), 1621-1634 (2018-08-15)
Diabetes increases oxidative stress in the retina and dysfunctions their mitochondria, accelerating capillary cell apoptosis. A 66 kDa adaptor protein, p66Shc, is considered as a sensor of oxidative stress-induced apoptosis. In the pathogenesis of diabetic retinopathy, a progressive disease, reactive oxygen
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.