설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGAGGCCTTGTGCTCAGAAATGAGAGCTGCAGTGAAAACTACACCACCGACTTCATTTACCAGCTGTATTCAGAAGAGGGCAAAGGCGTGTTTGACTGCAGGAAGAACGTGCTGGGTCACATGCAGCAGGGTGGGGCACCCTCTCCATTTGATAGAAACTTTGGAACCAAAATCTCTGCCAGAGCTATGGAGTGGATCACTGCAAAACTCAAGGAGGCCCGGGGCAGAGGAAAAAAATTTACCACCGATGATTCCATTTGTGTGCTGGGAATAAGCAAAAGAAACGTTATTTTTCAACCTGTGGCAGAGCTGAAGAAGCAAACGGATTTTGAGCACAGGATTCCCAAAGAACAGTGGTGGCTCAAGCTACGGCCCCTCATGAAAATCCTGGCCAAGTACAAGGCCAGCTATGACGTGTCGGACTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PFKP(5214), PFKP(5214)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Sheikh Mohammad Umar et al.
Experimental cell research, 396(1), 112282-112282 (2020-09-14)
In the present study, we have explored the prognostic value of the Phosphofructokinase Platelet-type (PFKP) expression and its therapeutic relevance in metastatic breast cancer. PFKP immunohistochemistry was performed on Invasive ductal carcinomas (IDCs; n = 87) of breast, and its association with
Chandra Prakash Prasad et al.
Oncotarget, 8(42), 71471-71488 (2017-10-27)
Here we investigated the impact of WNT5A signaling on aerobic glycolysis and evaluated its effects on breast cancer cell migration/invasion. WNT5A signaling reduced migration and lactate production and caused selective down-regulation of the glycolytic enzyme phosphofructokinase platelet-type (PFKP). These events
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.