설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGAGCTTGTGGCTTGAATGTTAAAGGTGTGACCACCGACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CEBPG(1054), CEBPG(1054)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yanhui Yu et al.
DNA and cell biology, 36(3), 212-218 (2017-01-17)
Autophagy is a main defense strategy by which infected host cells can virtually induce the killing of parasite, including Toxoplasma gondii. However, the regulatory mechanisms of autophagy in T. gondii-infected nonhematopoietic cells are still unknown. Emerging evidence indicates that CCAAT/enhancer-binding
Hyun Lim et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 76, 153255-153255 (2020-06-20)
Prolonged exposure to the senescence-associated secretory phenotype (SASP) with age leads to chronic low-grade inflammation in neighboring cells and tissues, causing many chronic degenerative diseases. The effects on SASP production of the ethanol extract from Scutellaria radix and 17 isolated
Nirmalya Dasgupta et al.
Biochimica et biophysica acta, 1861(7), 1777-1787 (2017-03-28)
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Hong Li et al.
Genetic testing and molecular biomarkers, 23(5), 304-309 (2019-04-11)
Aims: Metastasis is a significant obstacle to curing esophageal squamous cell carcinoma (ESCC). The CCAAT/enhancer binding protein β (C/EBPβ)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.