설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAAATGTATCCGCTGTCAACTACGAATTTGAGGATGAATACTTCAGTAATACCAGTGCCCTAGCCAAAGATTTCATAAGAAGACTTCTGGTCAAGGATCCAAAGAAGAGAATGACAATTCAAGATAGTTTGCAGCATCCCTGGATCAAGCCTAAAGATACACAACAGGCACTTAGTAGAAAAGCATCAGCAGTAAACATGGAGAAATTCAAGAAGTTTGCAGCCCGGAAAAAATGGAAACAATCCGTTCGCTTGATATCACTGTGCCAAAGATTATCCAGGTCATTCCTGTCCAGAAGTAACATGAGTGTTGCCAGAAGCGATGATACTCTGGATGAGGAAGACTCCTTTGTGATGAAAGCCATCATCCATGCCATCAACGATGACAATGTCCCAGGCCTGCAGCACCTTCTGGGCTCATTATCCA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DAPK1(1612), DAPK1(1612)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Zhenning Liu et al.
Immunologic research, 65(3), 687-698 (2017-02-20)
Paraquat can result in dysfunction of multiple organs after ingestion in human. However, the mechanisms of nucleotide-binding domain and leucine-rich repeat containing protein 3 (NLRP3) inflammasome activation in acute kidney injury have not been clearly demonstrated. The aim of this
Wei Xiong et al.
Journal of the neurological sciences, 387, 210-219 (2018-03-25)
Death-associated protein kinase 1 (DAPK1) is a kinase found to promote neuronal apoptosis induced by ischemia. Extracellular signal-regulated kinase (ERK) was identified as a key molecule in DAPK1 signaling. However, the mechanisms of neuronal ischemia reperfusion injury remain unknown. Here
Chang-Lin Zhai et al.
IUBMB life, 71(2), 166-176 (2018-11-13)
Cardiovascular ischemic disease is a large class of diseases that are harmful to human health. The significant role of microRNAs (miRNAs) in terms of controlling cardiac injury has been reported in latest studies. MiR-98 is very important in regulating the
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
The tumor suppressor DAPK inhibits cell motility by blocking the integrin-mediated polarity pathway.
Jean-Cheng Kuo et al.
The Journal of cell biology, 172(4), 619-631 (2006-02-16)
Death-associated protein kinase (DAPK) is a calmodulin-regulated serine/threonine kinase and possesses apoptotic and tumor-suppressive functions. However, it is unclear whether DAPK elicits apoptosis-independent activity to suppress tumor progression. We show that DAPK inhibits random migration by reducing directional persistence and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.