설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATGTCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Feng-Ning F Yuan et al.
International journal of oncology, 44(5), 1625-1633 (2014-03-15)
The secosteroidal hormone 1,25-dihyroxyvitamin D [1,25(OH)(2)D(3)] and its receptor, the vitamin D receptor (VDR), are crucial regulators of epidermal proliferation and differentiation. However, the effects of 1,25(OH)(2)D(3)-directed signaling on oral keratinocyte pathophysiology have not been well studied. We examined the
Roberta Lotti et al.
International journal of molecular sciences, 17(1) (2016-01-16)
Squamous Cell Carcinoma-derived Stem-like Cells (SCC-SC) originate from alterations in keratinocyte stem cells (KSC) gene expression and sustain tumor development, invasion and recurrence. Since survivin, a KSC marker, is highly expressed in SCC-SC, we evaluate its role in SCC-SC cell
Katiuscia Dallaglio et al.
International journal of molecular sciences, 14(10), 19540-19555 (2013-10-01)
In human epidermis, keratinocyte stem cells (KSC) are characterized by high levels of β1-integrin, resulting in the rapid adhesion to type IV collagen. Since epithelial tumors originate from KSC, we evaluated the features of rapidly adhering (RAD) keratinocytes derived from
Susanne Grether-Beck et al.
The Journal of investigative dermatology, 132(6), 1561-1572 (2012-03-16)
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.