콘텐츠로 건너뛰기
Merck

EHU013931

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP2

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BMP2(650), BMP2(650)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sarah Ouahoud et al.
Oncogene, 39(12), 2453-2466 (2020-01-25)
Patients with the mesenchymal subtype colorectal cancer (CRC) have a poor prognosis, in particular patients with stroma-rich tumors and aberrant SMAD4 expression. We hypothesized that interactions between SMAD4-deficient CRC cells and cancer-associated fibroblasts provide a biological explanation. In transwell invasion
Weijie Yang et al.
Journal of cellular biochemistry, 120(12), 19684-19690 (2019-08-23)
miR-129-5p is implicated in many diseases, such as laryngeal cancer and breast cancer. In this study, we studied the mechanism underlying the role of BMP2 in intervertebral disc degeneration (IDD). We used a luciferase assay system to determine the relationship
Long Yu et al.
Biochemical and biophysical research communications, 516(2), 546-550 (2019-06-27)
Circular RNAs (circRNAs) are emerging as important regulators in human disease. The expression profile and mechanism of circRNAs in postmenopausal osteoporosis remains largely unknown. Bone morphogenetic protein 2 (BMP2) is known to play important role in inducing osteogenic differentiation. MiR-98
Wei Wang et al.
Molecular pain, 15, 1744806918824250-1744806918824250 (2019-02-26)
Bone cancer pain is one of the most severe and intractable complications in patients suffering from primary or metastatic bone cancer and profoundly compromises the quality of life. Emerging evidence indicates that the dorsal root ganglion play an integral role
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.