description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGCAAACCAAGACACAGGAACTTGAAACCACTCAGAAACATTTGCAAGAAACAAAATTACAACTGGTTAAAGAGGAATATGTCTCTTCAGCCTTGGAAAGAACCGAGAAGACACTGCATGACACGGCCAGCAAGTTGCTTAACACGGTTAAAGAAACCACCAGGGCTGTATCTGGTCTACATTCTAAACTGGACCGCAAGAGAGCAATCGATGAGCACAACGCTGAAGCTCAGGAGAGCTTTGGCAAAAACCTCAACAGTCTGTTTAATAATATGGAAGAATTGATTAAGGATGGCAGTGCGAAACAAAAGGCCATGCTAGACGTTCATAAGACACTGTTTGGTAACCTGATGTCTTCTAGTGTCTCTGCATTAGACACCATTACCACGACAGCACTTGAATCTCTCGTGTCTATTCCAGAAAATGTGTCCGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... KIF11(16551), Kif11(16551)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Daniel Edinger et al.
Drug delivery and translational research, 4(1), 84-95 (2015-03-20)
Two antitumoral siRNAs (directed against target genes Eg5 and Ran) complexed with one of three sequence-defined cationic oligomers were compared in gene silencing in vitro and antitumoral in vivo efficacy upon intratumoral injection. Two lipo-oligomers (T-shape 49, i-shape 229) and
국제 무역 품목 번호
| SKU | GTIN |
|---|---|
| EMU017691-20UG | 04061831337921 |
| EMU017691-50UG | 04061831368833 |