콘텐츠로 건너뛰기
Merck

EHU019931

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF11

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wei Zhang et al.
Advanced healthcare materials, 5(12), 1493-1504 (2016-04-26)
Developing RNA-interference-based therapeutic approaches with efficient and targeted cytosolic delivery of small interfering RNA (siRNA) is remaining a critical challenge since two decades. Herein, a multifunctional transferrin receptor (TfR)-targeted siRNA delivery system (Tf&INF7) is designed based on siRNA complexes formed
Kai Zhu et al.
American journal of translational research, 11(4), 2245-2256 (2019-05-21)
Micro RNA (miRNAs) is a kind of non coding small RNAs with negative regulation function, which plays an important role in regulating the occurrence and development of tumors. In this study, we analyzed the expression level and role of miRNA-186-5p
Takeharu Imai et al.
Anticancer research, 37(1), 47-55 (2016-12-25)
Oesophageal squamous cell carcinoma (ESCC) and colorectal cancer (CRC) are common types of human cancer. Spheroid colony formation is used to characterize cancer stem cell (CSCs). In the present study, we analyzed the significance of kinesin family 11 (KIF11 in
Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Tatsuya Kato et al.
Molecular cancer research : MCR, 16(1), 47-57 (2017-10-11)
Inhibiting specific gene expression with siRNA provides a new therapeutic strategy to tackle many diseases at the molecular level. Recent strategies called high-density lipoprotein (HDL)-mimicking peptide-phospholipid nanoscaffold (HPPS) nanoparticles have been used to induce siRNAs-targeted delivery to

문서

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.