Skip to Content
Merck

EMU048301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppfibp1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGACCTGCGTGGATTGTTGGAGATGATGGAAACGGATGAGAAGGAAGGATTGAGATGCCAGATCCCAGATTCAACAGCAGAAGTGCTTATTGAGTGGCTTCAAAATCAAATGACAAATGGACATCTACCTGGGAATGGAGATGTGTATCAAGAAAGGTTGGCACGTCTAGAAAACGACAAGGAATCCCTCGTTCTTCAGGTAAGTGTGTTGACAGACCAGGTGGAGGCTCAGGGAGAGAAGATTCGGGATTTGGAGTTCTGTCTTGAAGAGCACAGAGAGAAGCTGAATGCCACTGAAGAAATGCTGCAGCAGGAGCTTCTGAGTAGGACCTCCTTAGAGACACAGAAGCTGGAGCTGATGGCTGAGATCTCTAACTTGAAGTTAAAACTGACGGCCGTAGAGAAGGACAGGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mieke W H Roeven et al.
Journal of immunotherapy (Hagerstown, Md. : 1997), 38(4), 145-154 (2015-04-04)
Dendritic cell (DC)-based vaccination is an appealing strategy to boost graft-versus-tumor immunity after allogeneic stem cell transplantation (allo-SCT), and thereby prevent or counteract tumor recurrence. By exploiting minor histocompatibility antigens (MiHA) presented on hematopoietic cells, donor CD8 T-cell immunity can
Mahdi Mojallal et al.
Nature communications, 5, 4557-4557 (2014-08-02)
The establishment and maintenance of apical-basal cell polarity is essential for the functionality of glandular epithelia. Cell polarity is often lost in advanced tumours correlating with acquisition of invasive and malignant properties. Despite extensive knowledge regarding the formation and maintenance

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service